Tomato Mutants Archive
HomeBrowse & Search > Strain List > Strain Detail

Strain Detail

Basic Information


Strain Id TOMJPT00074 
Strain Type T-DNA tag lines  
Cultivation record  
Total harvested seed 1.4ml  
Request
  set
 
Reference
>> Please submit your publication.

T-DNA

T-DNA 1
Seq Primer RB
Hit Region SL2.40ch01:19271..19331
TOMATOMISC GBrowse
Flanking Sequence TYTKRMSWWWKGTTGCTWAGCTMWTAACTC
MGAAACCCGCGGCTGAGTGGCTCCTTCAAC
GTTGCGGTTCTGTCAGTTCCAAACGTAAAA
CGGCTTGTCCCGCGTCATCGGCGGGGGTCA
TAACGTGACTCCCTTAATTCTCCGCTCATG
ATCAGATTGTCGTTTCCCGCCTTCAGTTTA
AACTATGAKGGTTGGACRTGATWTATTGAA
GGGKATCCCCAAAATAAARKASCGTTTATT
ATAATAGACAGCTTTCTACTTCACCAACCA
TGGCCSSCAACCACGCATGCCCTATCATCT
TATCTATTAAGTGTTCTTGAAATCTATCGT
TATCTTARTAARTGAGGTCGTTCTGGTGTC

Close Click to full size image in new window. When you click the name of "Strain" jump to each detail page.
Data setting error.