Tomato Mutants Archive
HomeBrowse & Search > Strain List > Strain Detail

Strain Detail

Basic Information


Strain Id TOMJPT00112 
Strain Type T-DNA tag lines  
Cultivation record  
Total harvested seed 1.9ml  
Request  
Reference
>> Please submit your publication.

T-DNA

T-DNA 1
Seq Primer RB
Hit Region SL2.50ch10:10159301-10160900
TOMATOMISC GBrowse
Flanking Sequence TTTGACTGTTAAAGGAAAAGGGGAATATGG
TTGGTGAATCACTATCTTGCTTTTGGTTTT
GTTATGCATTTAATTTTTTTATTTTTTATA
GTATTAAAGTACTTAATATACACATTTGAA
CAGGTTAGTTGACATTTGTTTTAGATTAAC
AATTAATTTTATGTTATCGTCTCCATTTAA
GGAGTTTTCTGAATGGACAGAGTAACACTA
ATTACGCTAGACTATACATTCATGTGGCTA
TCAGTCAGTGGTCCAATTAAAATAAACAAA
ATTCATTGGGTCAAAATATTAAAATTTGAA
ACGATGAAGGGTTTGTTTGATAGGAAGTTA
TTTACTTTCTAATATTTAATGGTAAAAAAA
TAATATCTTAMAACCACTTTTACACAARAS
ATAAGGCACAAGAATGTTCTARAWTATGAT
TGAAAATTTAATARACACGTTTAATTAAAT
TAACGTCCTATTAACGTTCTTCGKAMMTAA
TTTTWATTGAAAAACT

Close Click to full size image in new window. When you click the name of "Strain" jump to each detail page.
Data setting error.