Tomato Mutants Archive
HomeBrowse & Search > Strain List > Strain Detail

Strain Detail

Basic Information

Strain Id TOMJPA00090-1 
Strain Type Activation-tagged lines 
Cultivation record  
Total harvested seed 0.25ml  
Request Condition  Transgenic Permission: required
Request
  set

* We will send 3-15 seeds per set for each mutant line.

* If the seeds of the displayed line are out of stock including sterility, we will send mixed seeds (20-30 seeds) of sibling plants.

Reference
>> Please submit your publication.


Photo

*Click photo to enlarge.

T-DNA

T-DNA 1
Seq Primer C2K-817-Rv
Hit Region SL3.0ch02:37258492-37258862
TOMATOMISC GBrowse
Flanking Sequence ACANTGATCATTGTTATTTTAGAATTTNNN
ATATATATTAATATTTCGTTCCTCCTTCTA
GAGTAATTTTAGCGTATGATATGAAACCAC
GTCAGGATAATCATCTCTTTTTCTTTTTTA
GATTATCAATTTCATTTTTATGATGATAAG
TGTATAATTTTCTTAGATAAATTAATTTTT
TTAACATTGATCAATTGCTCTTATCCTTAC
TTCGCTGACACATAAGAGAGAGAGCACTTT
CCAAGTCAAGAATGAGTGTCAAAGAGAAGA
TGCGCAAGCTTGTCTATCAGAAGAAGAAAG
CGAGGGAGCGAAACTTTAGGTTTCATTAGG
ATAGACTGAAGCGTATATAGAAAAAAAAGT
TTCATTATTTGAAAAAAAAAAAAAAATNAA
ACAATTTATTTAAGGGGGCCCATCAAAAA

Comments

T-DNA1> Intergenic; Solyc02g065530; 2985bp to 5'UTR / Intergenic; Solyc02g065520; 3703bp to translation start site / Intergenic; Solyc02g065515; 5519bp to translation start site  

Close Click to full size image in new window. When you click the name of "Strain" jump to each detail page.
Data setting error.