homozygous mutant is sterile.
Originated from TOMJPW0469-2.
You can screen homozygous plant by PCR-sequence genotyping with primer #1(ATGGATAAAATATGCAACTC) and primer #2(GTGCCTTAGATTATATTCTC). PCR product size is 780bp. You can see the SNP on the picture.
CloseClick to full size image in new window. When you click the name of "Strain" jump to each detail page.