Tomato Mutants Archive
HomeBrowse & Search > Strain List > Strain Detail

Strain Detail

Basic Information

Strain Id TOMJPT00034-1 
Strain Type T-DNA-tagged lines 
Cultivation record  
Total harvested seed 0ml  
Request

* We will send 3-15 seeds per set for each mutant line.

* If the seeds of the displayed line are out of stock including sterility, we will send mixed seeds (20-30 seeds) of sibling plants.

* For request, please contact us.

Reference
>> Please submit your publication.


Photo

*Click photo to enlarge.

T-DNA

T-DNA 1
Seq Primer RB
Hit Region SL3.0ch06:37850424..37850251
TOMATOMISC GBrowse
Flanking Sequence AGCCNANGCTCTAGGACTTGAACCATANNT
NGTTTCCAAAAGTTTCAATGGGAACTTGGT
TTTTAAGAAAGGTTAATAANCCCGGGGCCC
TGGAAAAAGTATCTATGGGTTTTTTCGGCC
AGTCTACCCCCGNTATCGNAACGAAGTGTT
TTGTGTNNNTGGAANTTGGNCNAAAGTTGN
ATANNGCNATCGTGNNNCCNNANANNAN

Comments

T-DNA1> Gene; Solyc06g059840; exon_1st  

Close Click to full size image in new window. When you click the name of "Strain" jump to each detail page.
Data setting error.